nontargeting control grna  (Addgene inc)

Journal: bioRxiv

Article Title: Disruption of the epigenetic regulator BAP1 drives chromatin remodeling leading to the emergence of cells with breast cancer stem cell properties and aberrant glycosylation

doi: 10.1101/2024.12.12.628129

Figure Lengend Snippet: (A) CRISPR/Cas9 screening approach used for the identification of epigenetic regulator genes (ERGs) involved in the acquisition of mesenchymal breast cancer stem cell (BCSC) markers in non-tumorigenic breast cells. Adapted from Halaburkova et al. 2020 . gRNA: guide RNA. (B) Representation of enriched ERG gRNAs (false discovery rate [FDR] < 0.05) identified in the mesenchymal BCSC-like population of MCF10A cells infected with the ERG gRNA library compared to the bulk of cells on the day of sorting (n=2 MCF10A-Cas9 expressing clones). (C) Venn diagram of ERGs showing single nucleotide alterations in BC patients (TCGA-BRCA) of different molecular subtypes. Top 7 mutated ERGs identified in the TNBC subtype (proportion of SNAs (pSNA) > 0.019) are highlighted. (D) Kaplan-Meier analysis of disease-free survival in BC patients (TCGA-BRCA) divided in high and low BAP1 gene expression groups. * P < 0.05, ** P < 0.01.

Article Snippet: Nontargeting gRNA LentiArray CRISPR Negative Control Lentivirus (Thermo Fisher Scientific) was used as a negative control.

Techniques: CRISPR, Infection, Expressing, Clone Assay

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: SETD2 safeguards the genome against isochromosome formation.

doi: 10.1073/pnas.2303752120

Figure Lengend Snippet: Fig. 1. Setd2 loss causes chromatin mis-segregation during mitosis. (A) Images of wild-type, heterozygous or homozygous deletion of Setd2 have lagging (blue arrows) and bridging (orange arrows) chromosomes during the anaphase. MEFs with no, one, or two floxed alleles of Setd2 (Wild-type/WtFlox/Wt, and Flox/Flox, respectively) were either treated with vehicle (EtOH, control in top panels) or 4-OHT (excise floxed alleles of Setd2, bottom panels) for 3 d, fixed, and counterstained with Hoechst (gray). Scale bars are 5 µm. (B) Quantification of chromosome segregation errors during the anaphase and early telophase in control (vehicle-treated) or 4-OHT-treated MEFs described in (A). n = 198 wt/wt vehicle, n = 215 wt/wt 4-OHT, n = 298 fl/wt vehicle, n = 227 fl/wt 4-OHT, n = 258 fl/fl Vehicle, n = 225 fl/fl 4-OHT cells across 2 (wt/wt), 4 (fl/wt), and 3 (fl/fl) biological replicates. P values derived from an unpaired t test of normal cell values between treatment groups for each genotype. (C) Images of anaphases in control (untreated) or doxycycline-treated HeLa cells expressing tetracycline-inducible Cas9 (TetOn-Cas9) and single-guide RNA (sgRNA) that are nontargeting (NT) or specific for SETD2. Cells are counterstained with Hoechst (gray). Lagging (blue) and bridging (orange) chromosomes occur in cells lacking SETD2. Scale bars are 5 µm. (D) Quantification of chromosome segregation errors during the anaphase and early telophase in cells described in (C). n = 183 sgNT control, n = 190 sgNT dox., n = 198 sgSETD2.1 control, n = 240 sgSETD2.1 dox., n = 187 sgSETD2.2 control, n = 246 sgSETD2.2 dox. cells across three biological replicates. P values derived from an unpaired t test of normal cell values between treatment groups for each sgRNA background. (E) Image of Setd2fl/fl MEFs treated with 4-OHT (at left), showing nuclear defects that occur in interphase after 3 d treatment. Scale bars are 50 µm (top images) and 5 µm (grayscale images at the bottom). (F) Quantifications of nuclear phenotypes from images described in (E) for Setd2 MEFs. n = 450 wt/wt vehicle, n = 617 wt/wt 4-OHT, n = 650 fl/wt vehicle, n = 509 fl/wt 4-OHT, n = 736 fl/fl Vehicle, n = 687 fl/fl 4-OHT cells across three biological replicates. P values derived from an unpaired t test of normal cell values between treatment groups of each genotype. (G) Quantification of interphase bridges observed in cell images described in (E). P values derived from an unpaired t test of normal cell values between treatment groups each genotype. Error bars are SD.

Article Snippet: HeLa TetOn- Cas9 cells were transduced with 8 μg/mL polybrene (Millipore Sigma, TR- 1003) and viral supernatant for guides targeting SETD2 or nontargeting control sgRNA (Addgene, 80189).

Techniques: Control, Derivative Assay, Expressing

Journal: Molecular carcinogenesis

Article Title: SUMO1 degrader induces ER stress and ROS accumulation through deSUMOylation of TCF4 and inhibition of its transcription of StarD7 in colon cancer.

doi: 10.1002/mc.23560

Figure Lengend Snippet: FIGURE 1 StarD7 is overexpressed in colon cancer and required for the cancer growth. (A, B) The expression of StarD7 mRNA in different types of human cancers (A) and colon cancer (B) as compared with matched normal tissues from TCGA and GTEx cohorts (*p < 0.05; **p < 0.01; ***p < 0.001). (C, D) The expression of StarD7 protein in several types of human cancer (C) and colon cancer (D) and matched normal colon tissues from CPTAC data set. (E) Human colon cancer tissue and matched adjacent normal tissue were analyzed by western blots for StarD7 protein levels. (F) CRISPR‐Cas9 knockout of StarD7 (sgStarD7) and sgRNA control (sgCont) HCT116 clones were analyzed by western blots for StarD7 protein levels with β‐actin as the loading control. (G) StarD7 knockout clones (sgStarD7#7 and #15) and sgCont clones were analyzed for cell growth by cell number counting (n = 3; ***p < 0.001 by Student's t test). (H) HCT116 sgStarD7 and sgCont clones (5 × 106) were inoculated subcutaneously into mice (±SEM (n = 8 per group, **p < 0.01; Wilcoxon test). (I) The survival of the mice bearing HCT116 sgStarD7 and sgCont clones was evaluated by Kaplan–Meier survival curve (***p < 0.001). (J) The xenografts were removed and analyzed by western blots for StarD7 protein levels with β‐actin as the loading control in the xenografts generated from sgStarD7 and sgCont HCT116 clones. ns, not significant; TCGA, the Cancer Genome Atlas.

Article Snippet: The sequences for StarD7 CRISPR were as follows: StarD7, Oligo 1: 5′‐CACCGCGTTAGCCGGCGTCTTCGTT‐3′, Oligo 2: 5′‐AACAACGAAGACGCCGGCTAA CGC‐3′, and the sequences for nontargeting control CRISPR (Addgene #80248) were as follows: Oligo1, 5′‐ CACCGGTATTACTGATATTGGTGGG‐3′, Oligo2, 5′‐AAACCCCACCAATATCAGTAATACC‐3′.

Techniques: Expressing, Western Blot, CRISPR, Knock-Out, Control, Clone Assay, Generated